Review



flag bcl  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    Addgene inc flag bcl
    Flag Bcl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 31 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/flag+bcl/Flag-Bcl2+(Plasmid+%2318003)/pm36167829-451-2-5
    Average 93 stars, based on 31 article reviews
    flag bcl - by Bioz Stars, 2026-09
    93/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: Development of a BCL-xL and BCL-2 dual degrader with improved anti-leukemic activity,
    Article Snippet: .. Flag-BCL-2 was a gift from Clark Distelhorst (Addgene plasmid # 18003, Watertown, MA, USA). .. Plasmids Flag-BCL-xL-K16-only, Flag-BCL-xL-K20-only, Flag-BCL-xL-K157-only, Flag-BCL-xL-K-ko-R34K, Flag-BCL-xL-K-ko-R102K, Flag-BCL-xL-K-ko-R132K, Flag-BCL-xL-K-ko-G186K, Flag-BCL-2-K17R, Flag-BCL-2-K22R, and Flag-BCL-2-K17/22R were constructed by using Q5® Site-Directed Mutagenesis Kit (Cat. No. E0554S, NEB, Ipswich, MA, USA) and the following primer sets.

    Article Title: Development of a BCL-xL and BCL-2 dual degrader with improved anti-leukemic activity.
    Article Snippet: .. Flag-BCL-2 was a gift from Clark Distelhorst (Addgene plasmid # 18003, Watertown, MA, USA). .. Plasmids Flag-BCL-xL-K16-only, Flag-BCL-xL-K20-only, Flag-BCL-xL-K157-only, FlagBCL-xL-K-ko-R34K, Flag-BCL-xL-K-ko-R102K, Flag-BCL-xL-K-ko-R132K, FlagBCL-xL-K-ko-G186K, Flag-BCL-2-K17R, Flag-BCL-2-K22R, and Flag-BCL-2-K17/ 22R were constructed by using Q5® Site-Directed Mutagenesis Kit (Cat. No. E0554S, NEB, Ipswich, MA, USA) and the following primer sets.

    Sequencing:

    Article Title: TP53 mutations and RNA-binding protein MUSASHI-2 drive resistance to PRMT5-targeted therapy in B-cell lymphoma
    Article Snippet: .. GFP-P53 and FLAG-BCL-2 were from Addgene (Cambridge,MA). pLKO_TRC005 vector was used for silencing PRMT5 (sequence: 5′-AGGGACTGGAATACGCTAATT-3′). pLKO_TRCN0000062809 Sequence of MSI2 shRNA (sequence:5′CCGGGTGGAAGATGTAAAGCAATATCTCGAGATATTGCTTTACATCTTCCACTTTTTG-3′). ..

    Article Title: TP53 mutations and RNA-binding protein MUSASHI-2 drive resistance to PRMT5-targeted therapy in B-cell lymphoma.
    Article Snippet: .. GFP-P53 and FLAG-BCL-2 were from Addgene (Cambridge,MA). pLKO_TRC005 vector was used for silencing PRMT5 (sequence: 5′-AGGGACTGGAATACGCTAATT-3′). pLKO_TRCN000006 2809 Sequence of MSI2 shRNA (sequence:5′CCGGGTGGAAGATGT AAAGCAATATCTCGAGATATTGCTTTACATCTTCCACTTTTTG-3′). ..

    shRNA:

    Article Title: TP53 mutations and RNA-binding protein MUSASHI-2 drive resistance to PRMT5-targeted therapy in B-cell lymphoma
    Article Snippet: .. GFP-P53 and FLAG-BCL-2 were from Addgene (Cambridge,MA). pLKO_TRC005 vector was used for silencing PRMT5 (sequence: 5′-AGGGACTGGAATACGCTAATT-3′). pLKO_TRCN0000062809 Sequence of MSI2 shRNA (sequence:5′CCGGGTGGAAGATGTAAAGCAATATCTCGAGATATTGCTTTACATCTTCCACTTTTTG-3′). ..

    Article Title: TP53 mutations and RNA-binding protein MUSASHI-2 drive resistance to PRMT5-targeted therapy in B-cell lymphoma.
    Article Snippet: .. GFP-P53 and FLAG-BCL-2 were from Addgene (Cambridge,MA). pLKO_TRC005 vector was used for silencing PRMT5 (sequence: 5′-AGGGACTGGAATACGCTAATT-3′). pLKO_TRCN000006 2809 Sequence of MSI2 shRNA (sequence:5′CCGGGTGGAAGATGT AAAGCAATATCTCGAGATATTGCTTTACATCTTCCACTTTTTG-3′). ..



    Similar Products

    bcl2 flag  (Sino Biological)
    93
    Sino Biological bcl2 flag
    Bcl2 Flag, supplied by Sino Biological, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/flag+bcl/Human+BCL2%2FBcl-2+transcript+variant+alpha+Gene+ORF+cDNA+clone+expression+plasmid%2C+C-Flag+tag/pmc12343803-118-2-17
    Average 93 stars, based on 1 article reviews
    bcl2 flag - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    flag-tagged bcl-3 plasmid  (Thermo Fisher)
    90
    Thermo Fisher flag-tagged bcl-3 plasmid
    Flag Tagged Bcl 3 Plasmid, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/flag+bcl/anti+bcl3/pm39943627-163-3-9
    Average 90 stars, based on 1 article reviews
    flag-tagged bcl-3 plasmid - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    plasmids hg10195 nf sino biological  (Sino Biological)
    93
    Sino Biological plasmids hg10195 nf sino biological
    Plasmids Hg10195 Nf Sino Biological, supplied by Sino Biological, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/flag+bcl/Human+BCL2%2FBcl-2+transcript+variant+alpha+Gene+ORF+cDNA+clone+expression+plasmid%2C+N-Flag+tag/pmc11605354__BLOODA_ADV___2024___013699___mmc2-56-24-27
    Average 93 stars, based on 1 article reviews
    plasmids hg10195 nf sino biological - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    monoclonal anti flag m2 antibody  (Cell Signaling Technology Inc)
    97
    Cell Signaling Technology Inc monoclonal anti flag m2 antibody
    Monoclonal Anti Flag M2 Antibody, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/flag+bcl/Bcl-2+Rabbit+mAb/pmc10861516__41467_2024_45539_MOESM3_ESM-114-25-24
    Average 97 stars, based on 1 article reviews
    monoclonal anti flag m2 antibody - by Bioz Stars, 2026-09
    97/100 stars
    		  Buy from Supplier
    p-bcl-3-flag  (Schmid GmbH)
    90
    Schmid GmbH p-bcl-3-flag
    P Bcl 3 Flag, supplied by Schmid GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/flag+bcl/b+cell+lymphoma+3++bcl+3++protein/pm38238702-47-0-7
    Average 90 stars, based on 1 article reviews
    p-bcl-3-flag - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    flag bcl  (Addgene inc)
    93
    Addgene inc flag bcl
    Flag Bcl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/flag+bcl/Flag-Bcl2+(Plasmid+%2318003)/pm36167829-451-2-5
    Average 93 stars, based on 1 article reviews
    flag bcl - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    flag bcl 2 er  (Addgene inc)
    93
    Addgene inc flag bcl 2 er
    Flag Bcl 2 Er, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/flag+bcl/Flag-Bcl2+(Plasmid+%2318003)/pm35273168-344-1-9
    Average 93 stars, based on 1 article reviews
    flag bcl 2 er - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    flag bcl 2 wt  (Addgene inc)
    93
    Addgene inc flag bcl 2 wt
    Flag Bcl 2 Wt, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/flag+bcl/Flag-Bcl2+(Plasmid+%2318003)/pm35273168-344-0-9
    Average 93 stars, based on 1 article reviews
    flag bcl 2 wt - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    flag bcl 2 mito  (Addgene inc)
    93
    Addgene inc flag bcl 2 mito
    Flag Bcl 2 Mito, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/flag+bcl/Flag-Bcl2+(Plasmid+%2318003)/pmc08913617-344-3-9
    Average 93 stars, based on 1 article reviews
    flag bcl 2 mito - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier

    Image Search Results